Spotted during a meeting at the Environment Agency’s office in Penrith: a biscuit shaped like a diatom. In a box of Morrison’s Continental Selection Biscuits, if you are interested. My professional judgement is that the biscuit-maker had Cocconeis on his (or her) mind during the design phase.
Having introduced the subject of molecular barcodes as a means of identifying plants some months ago (“Berlin and barcodes”), I thought I should show you what a barcode actually looks like:
ATGTCTCAATCTGTATCAGAACGGACTCGAATTAAAAGTGACCGTTACGAATCTGGTGTAATCCC
TTACGCTAAAATGGGTTACTGGGATGCTTCATACGCAGTAAAAACAACTGATATTTTAGCATTAT
TCCGTATTACACCACAACCAGGTGTAGATCCAGTAGAAGCAGCAGCTGCAGTAGCAGGTGAATCT
TCTACAGCTACATGGACAGTTGTATGGACTGATTTATTAACAGCTTGTGACCGTTACCGTGCTAAA
GCTTACCGTGTAGATCCAGTTCCAAACACAACAGATCAATACTTCGCTTTCATCGCATATGAATGT
GACTTATTCGAAGAAGGTTCTTTAGCTAACTTAACAGCGTCTATCATTGGTAACGTTTTCGGTTTT
AAAGCAGTTGCTGCTTTACGTTTAGAAGATATGCGTATTCCTCACTCATACTTAAAAACATTCCA
AGGTCCAGCTACTGGTATCATTGTAGAACGTGAACGTTTAAACAAATACGGTATTCCGTTATTAG
GTGCTACTGTAAAACCTAAATTAGGTTTATCTGGTAAAAACTACGGTCGTGTAGTTTTCGAAGGT
TTAAAAGGTGGTTTAGACTTCTTAAAAGATGATGAAAACATTAACTCACAACCATTCATGCGTT
GGAGAGAACGTTTCTTATACTGTATGGAAGGTATTAACCGTGCATCAGCAGCTACAGGTGAAGTT
AAAGGTTCATACTTAAACATCACAGCAGCTACTATGGAAGAAGTATACAAACGTGCTGAGTATG
CTAAAGCTGTTGGTTCTATCGTTGTTATGATCGATTTAGTAATGGGTTATACTGCAATCCAAAGTA
TTGCTTTATGGTCTCGTGAAAACGATATGCTTTTACACTTACATCGTGCTGGTAACTCTACTTACGC
TCGTCAAAAGAACCATGGTATTAACTTCCGTGTTATCTGTAAATGGATGCGTATGTCTGGTGTAGA
TCATATCCACGCTGGTACAGTTGTTGGTAAATTAGAAGGTGATCCTTTAATGATTAAAGGTTTCTA
CGACACATTACGTTTAACAACATTAGACGTTAACTTACCTTACGGTATTTTCTTCGAAATGTCTTGG
GCTAGTTTACGTAAATGTATGCCTGTTGCGTCTGGTGGTATCCACTGTGGTCAAATGCACCAATTAA
TTCACTATTTAGGTGATGACGTAGTATTACAATTCGGTGGTGGTACAATTGGTCACCCTGATGGTAT
TCAAGCTGGTGCTACAGCTAACCGTGTTGCTTTAGAAGCAATGGTATTAGCTCGTAACGAAGGTGTA
GATTACTTCAATAACGCTGTAGGTCCTCAAATTTTACGCGATGCTGCTAAAACATGTGGTCCATTAC
AAACAGCTTTAGATTTATGGAAAGATATTTCTTTCAACTACACATCTACAGATACAGCTGATTTC
What we are looking at here is one small part of the gene that codes for the larger of the two subunits of RuBisCO, RbcL. A, G, T and C refer to the four nucleosides (adenosine, guanine, thymine and cytosine) which make up DNA. Think of this as the blueprint for one component of a type of diatom (Navicula lanceolata, in this case). The carburettor in your car is basically the same as the carburettor in every other car, but a mechanic still has to make sure that the carburettor he fits to your car is the one that was designed for that model. In the same way, the RuBisCo “component” differs very slightly between species. 
Six of the 45 populations of Navicula lanceolata collected and cultured for our DNA barcoding project. All 45 populations differ by no more than three of the 1446 base pairs in the RbcL barcode. The scale bar is 10 micrometres (= 1/100th of a millimetre) long.
If you have spent years learning the craft of identifying any group of organisms by traditional means, the use of molecular barcodes can seem like cheating. The string of nucleosides reduces all the complexities of form and function to a charmless abstraction. More importantly, you can’t see how the organism lives and how it interacts with the other organisms around it. It epitomises all that is bad with reductionism in ecology.
Yet those of us who study diatoms are already offenders in this regard. The focus of our attention for over a hundred years has been the silica “shell” (or “frustule”, to use the correct term). The live organisms have to be “cleaned” with acids and oxidising agents to remove all the soft materials. What we are left with is, itself, no more than a cipher of the true organism. We look down our microscopes and a series of visual stimuli – length, breadth, outline, the presence of different types of mark upon the frustule – all link to particular names. Diatomists have been using the empty shells, in effect, as “visual barcodes” for a long time. Indeed, many diatoms have only ever been described in this state.
One of my long-term gripes is that diatomists have lost touch with the world of functional ecology. We name diatoms, count the number of each species, and then look for associations between species and particular features of their environment. Navicula lanceolata, the subject of this post, has distinct habitats and preferences that can only be discerned from looking at the live organism (see “Coxhoe” from March 2013). As a relatively large and distinctive diatom, it is quite easy to find under the microscope, particularly if you are willing to brave the cold conditions that it prefers. Other diatoms are not so easy to recognise in their live state. What nuances of their ecology are we missing as a result?
Looking down my microscope at a sample from the upper Ehen a couple of months ago, I saw something that I was not expecting. The geology of the catchment of the River Ehen means that the water in this area is very soft yet here was an alga I usually associated with strongly calcareous geology. I double checked to make sure that I had not made a mistake and, once I was confident of my identification, I wondered if it was a freak occurrence (see “When is a record not a record?”).
The organism that I was looking at was a species of the cyanobacterium (blue-green alga) Rivularia, which we last saw in Upper Teesdale (“Blue skies and blue flowers in Upper Teesdale”). In Upper Teesdale it formed distinct hemispherical colonies yet here I could just see bundles of filaments. Maybe they were fragments of colonies washed in from elsewhere or which I had disrupted as I had collected my samples? One other difference is that the Upper Teesdale samples all had calcite crystals within the colonies whereas my samples from the soft water of the River Ehen lacked these.
The cyanobacterium Rivularia from the upper River Ehen, March 2013. The main image shows a bundle of filaments in sheaths with a single filament in the inset. The arrows indicate the heterocysts. Scale bar: 10 micrometres ( = 100th of a millimetre).
Brian Whitton and Alan Pentecost summarised their records of Rivularia in a short article in The Phcyologist and commented that all but one came from catchments where there was some limestone (the exception was Haweswater in the Lake District). This sample from the River Ehen is, therefore, unusual for the UK although we do know that Rivularia is found in soft waters in Norway, including the River Atma, subject of several posts back in July 2013.
Since I first noticed it in November, I have seen it at the most upstream of my four sites on the River Ehen every time I have visited. It is possible that “chance favours the prepared mind”: I didn’t “see” what I was not expecting but, having found it once, I was alert to its presence on every subsequent visit. On the other hand, I have looked at many other samples from soft water habitats and am fairly confident that there was no Rivularia present in these. And I am sure that Brian and Alan have also looked at enough soft water habitats for their generalisation about Rivularia’s preference for calcareous habitats to be sound.
And why just at this one site and not at the others, all within about four kilometres of the lake outfall? What is so special about this particular location? Part of my fascination with the lower plants is that we can still make discoveries, still turn preconceptions on their heads, still approach a visit even to a familiar site with anticipation …
Back in May last year, I wrote about Arthur Scott Donkin, a Victorian forensic pathologist who was an amateur microscopist with a penchant for diatoms. Donkin would probably be surprised to hear that diatoms now play a role in forensic science, and that he missed the chance to combine his hobby and day job. UK readers might be interested in a recent episode of the crime drama Silent Witness, where diatoms have a walk-on part, though I cannot comment on the veracity of the example itself. Suffice it to say that my limited experience as an expert witness is enough for me to be fairly confident that a forensic pathologist would not be cross-examined on the diatom evidence. The good news, if you have a limited tolerance for TV crime dramas, is that diatoms have their fifteen minutes of fame close to the start of episode one.
Fieldwork in January is always a mixed blessing. On the one hand, you get a break from the tedium of office- and lab-based activities that dominate the ecologist’s winter agenda. On the other hand, there is the weather. It is only when the water is freezing and the wind is blowing that you realise just how reliant we are on our fingers. At each site I have to pick stones from the riverbed, then manipulate forceps to collect fragments of the different organisms present, and finally write some legible notes in my field book.
A year or so ago, I found a partial solution in the form of a box of veterinarian’s disposable gloves which extend right up my arm. A cyclist’s reflective ankle band then holds the top of the glove in place while I plunge my arm into the river. This means that I don’t need to remove outer layers of clothing before plunging my arm into the water, though the thin plastic of the gloves offers no insulation to my hand itself.
The second problem we face is that we are wholly at the mercy of the river flow. Life is easier now than in the past because you can get real-time readings of flow from the Environment Agency’s website. The knack is to translate the number that you read on the web page into a meaningful indication of risk. After visiting the Ehen for over a year, and comparing what I see with the hydrographs, I now know that a flow of about 100 MLD (mega-litres per day) means that the water comes no higher than my calves whilst 500 MLD is the limit for safe working. And today’s hydrograph reads … 500 MLD.
So here’s my question: if the river is flowing so fast that I can only just stand up, and if there have been a series of spates over the past couple of weeks, what is this going to do to all the algae that live on the stones at the bottom of the river? The answer will surprise everyone but me. The reason I am not surprised is that I am the one trying to stand up in the river and one of the problems I face is that the rocks beneath my feet are slippery with algae (remember “healthy streams are slippery streams …”?).
We’re using a device called a “Benthotorch” to measure the quantity of algae on the river bed. This is a portable fluorimeter, calibrated to measure the amount of chlorophyll on a given area of stone. The more algae there are on the stones the greater the concentration of chlorophyll that we record. When I collated all the evidence we’ve patiently collected over the past year, it becomes clear that there to be much more algae in the winter than in the summer. Substantially more. What is going on?
Maria using a benthotorch to measure chlorophyll concentrations on stones from the River Ehen, February 2013.
The summer values are, perhaps, the easier to explain: on most of our visits here during the summer we noticed lots of tiny midge larvae on the stone surfaces (see “A very hungry chironomid …“). These were munching their way through the algae and, in turn, were being eaten by larger invertebrates and fish. The low chlorophyll measurements, in other words, are a result of natural process in a healthy ecosystem. The larger quantities we find in the winter can partially be explained by the same mechanism: the cold weather means that the bugs are not so active, meaning that algae tend to accumulate rather than being converted into midge larvae.
Variation in chlorophyll concentrations on stones in the upper River Ehen. Bars are the average values of five replicate measurements from each of four sites. No data were collected in December 2012 or January 2013.
But if I have trouble keeping my feet in the fast current of the River Ehen, how come those algae that do accumulate are not washed away? Some of the algae will be removed by the current. Sand and gravel carried by the stream will abrade the surface of the stones and, at high velocities, the stones themselves will be rolled downstream. Yet it is easy to over-estimate the effect of the stream itself. The stream bed generates a huge amount of friction which slows the flow of water in the centimetre or so closest to the bottom to almost zero. The physics befuddle me but better brains than mine have worked out that life in this “boundary zone” can carry on whilst those of us who set out to study it are struggling to keep our feet.
If you go to the cinema to see the Nelson Mandela biopic Long Walk to Freedom you will see one scene, set on Robben Island, when Mandela and the other political prisoners are working on the seashore, with Cape Town and Table Mountain visible in the distance, across the water.
In the book on which the film is based, Mandela explains what they were doing:
“We were instructed to pick up the large pieces of seaweed that had washed up on the beach, and wade out to collect weed attached to rocks or coral. The seaweed itself was long and slimy and brownish-green in colour. Sometimes the pieces were six to eight feet in length and thirty pounds in weight. After fishing out the seaweed from the shallows, we lined it up in rows on the beach. When it was dry, we loaded it into the back of the truck. We were told it was then shipped to Japan where it was used as a fertiliser.”
The seaweed sounds like Ecklonia maxima, or possibly a species of Laminaria, which are harvested for a variety of purposes, not just as fertiliser (see Of Sea bamboo, split-fan kelp and bladder kelp). There is a huge literature on the commercial exploitation of seaweeds, with the prospect of using them as “biofuels” being just the latest of many trends. Mandela’s experience, however, illustrates a recurring theme: that the theoretical potential of the huge quantities of algae in nearshore waters is difficult to convert into profit. On Robben Island, for example, the prisoners provided free labour to make the enterprise economically viable. The biofuel debate is, similarly, as much about economics as it is about algae. It is only as other fuels become more expensive that the costs of harvesting algae start to look attractive.
Harvesting seaweed seems, from Mandela’s account, to be one of the few bright points in his time on Robben Island. Part of this was because the co-lateral of seaweed harvesting was a plentiful supply of seafood which they popped into a pot of boiling water sitting on an open fire on the seashore:
“When it was ready, the warders would join us and we would all sit down on the beach and have a kind of picnic lunch. In 1973, in a smuggled newspaper, we read about the wedding of Princess Anne and Mark Phillips, and the story detailed the bridal luncheon of rare and delicate dishes. The menu included mussels, crayfish and abalone, which made us laugh; we were dining on such delicacies every day.”
Just before Christmas, I reported on the first record of Achnanthidium catenatum for the UK, from a lake in Wales and pondered, in this post, what we meant by a “record” of a diatom. Simply finding a few empty valves (the silica cell walls) is not, by itself, evidence that there ever was a viable population of A. catenatum in Llyn Padern. What, indeed, should we use as criteria for regarding this as a new addition to the UK flora?
My instinct is that the more valves I find in a sample, the greater the probability that these indicate the existence of a viable population. Even so, it could still just indicate the presence of a population at one point on one occasion. If I were able to find A. catenatum at several locations around the lake, or at the same point over an extended period of time then, perhaps, we can conclude that it is an established part of the flora of this lake and, therefore, of the UK.
What if I cannot demonstrate this, even after visits to Llyn Padern? We know that it was present (albeit as dead cells) in the summer of 2013 but is this enough to add it to a list of UK records? Perhaps those of us who study algae need to adopt the practice of ornithologists of distinguishing between species that nest and breed in the UK (“British Residents”) and those that are “Summer/Winter Visitors” or “Passage Migrants”? (apologies to Northern Irish readers, but the website www.birdsofbritain.co.uk does not appear to make any distinction between UK and Great Britain).
In other words, we should aspire to a two-tiered checklist that accounts for the often erratic occurrences of microorganisms that are readily dispersed by a variety of physical and biological agents. Then again, a further complication is that populations may lay dormant for long periods and then proliferate for short periods, so our one-off record may actually have been present for much longer, but was missed.
And there’s a final problem: too often our records simply reflect the activities of the small number of people who collect and analyse diatoms and other microscopic organisms, making it very hard to understand how distribution patterns vary in space and time.
And, finally, you might well be asking whether these questions are relevant. In my opinion, yes they are, partly because it puts the diversity of the microbial world into context. According to www.rspb.org.uk there are 574 bird species recorded from the UK. There are at least four times as many species of freshwater diatoms, and about 10 times as many species, if we include all freshwater algae. There is a huge amount of diversity tucked away in a group of organisms that is largely overlooked or ignored.
I spent Friday in a meeting on the eighth floor of the Natural History Museum’s Darwin Centre and took this photograph out of the window during one of the breaks. The two towers on the right hand side of the image are the towers you see as you walk up towards the front entrance of the museum. The diatom herbarium was located in the right hand tower until just a year or so ago. Just to their left, if you look carefully, you can see the towers of Battersea power station, which graced the cover of Pink Floyd’s Animals back in the 1970s.
The view from the eighth floor of the Darwin Centre at the Natural History Museum, January 2014.
I was at the Natural History Museum for a council meeting for the British Phycological Society and, as ever, sat wondering why we persist with such an obscure name. “Phycology” refers to the study of algae, responsible for about half of global primary productivity and about 75% of Britain’s photosynthetic biodiversity. Yet most people would probably look befuddled if you asked them what it meant. Even Google comes back with “did you mean: psychology?” when you type “phycology” into the search engine.
Brian Whitton recalls, in the early days of the society, advocating the term “algology” over “phycology” but being told by an older, more venerable member, that “algology” involved attaching a Latin prefix (“alga”) to a Greek suffix (“-logy”), so the all-Greek ‘phycology’ won the day. Strange that. We have lived quite happily with the term “television” for much longer, despite it, too, being a Latin-Greek hybrid. At least the 400 members of the society know what we mean, even if hardly anyone else does.
microscopesandmonsters 